View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11264_high_2 (Length: 228)

Name: NF11264_high_2
Description: NF11264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11264_high_2
NF11264_high_2
[»] chr8 (6 HSPs)
chr8 (16-213)||(38799255-38799452)
chr8 (16-213)||(38822065-38822262)
chr8 (20-211)||(43479849-43480040)
chr8 (16-213)||(25865460-25865657)
chr8 (16-213)||(26591928-26592125)
chr8 (16-213)||(41943704-41943901)
[»] chr7 (3 HSPs)
chr7 (16-211)||(21317336-21317531)
chr7 (20-211)||(3930136-3930327)
chr7 (39-145)||(3928803-3928909)
[»] chr2 (4 HSPs)
chr2 (20-211)||(13576110-13576301)
chr2 (16-94)||(34571617-34571695)
chr2 (16-97)||(34579085-34579166)
chr2 (16-97)||(34584834-34584915)
[»] chr5 (5 HSPs)
chr5 (21-213)||(12531252-12531444)
chr5 (21-213)||(12547175-12547367)
chr5 (42-211)||(9866853-9867024)
chr5 (42-145)||(9869843-9869946)
chr5 (108-172)||(9894450-9894514)
[»] scaffold0197 (1 HSPs)
scaffold0197 (16-211)||(30774-30968)
[»] chr4 (2 HSPs)
chr4 (16-213)||(24860306-24860503)
chr4 (16-213)||(34748515-34748712)
[»] chr1 (2 HSPs)
chr1 (154-213)||(7594905-7594964)
chr1 (24-76)||(7594438-7594490)


Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 38799452 - 38799255
Alignment:
Q  16 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggctt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  38799452 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaacagttccaggtctgaatctatgtggctt 38799353  T
Q  116 cttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  38799352 cttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgccgccggtggatttgcgagctgtttgct 38799255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 213
Target Start/End: Original strand, 38822065 - 38822262
Alignment:
Q  16 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggctt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  38822065 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaacagttccaggtctgaatctatgtggctt 38822164  T
Q  116 cttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  38822165 cttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgccgccggtggatttgcgagctgtttgct 38822262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 20 - 211
Target Start/End: Original strand, 43479849 - 43480040
Alignment:
Q  20 ttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttc 119  Q
    |||||||||||| || | |||||||||||| || |||||||||||||| |||||||| |  | |||||| |||||||| | |||||| ||||||||||||    
T  43479849 ttggaatggaagcttcctgatgagaagctcggtactcttctgatacttgcggatctcacgaagagcaacagttccaggacggaatctgtgtggcttcttc 43479948  T
Q  120 actcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttg 211  Q
    ||||||||||| ||||||||||||||||||||||| ||||||||||| || ||||  ||||| || || ||||||||||||||||| |||||    
T  43479949 actcctccggtggccggagctgatttccgagcggctttggtggcgagttgtttccttggagctttgccaccggtggatttgcgagcggtttg 43480040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 25865657 - 25865460
Alignment:
Q  16 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggctt 115  Q
    |||| ||||||||||| |||||||| | ||||||||| ||||||||||||||||||||||| |  | |||||| |||||||| |   | | ||| |||||    
T  25865657 gacgctggaatggaagcttacggatcaaaagctcagtactcttctgatacttacggatctcacgaagagcaacggttccaggacgataacgatgaggctt 25865558  T
Q  116 cttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 213  Q
    ||||||||| ||||| |  ||||| |||||||  || || ||||| ||||| |||||||  || ||||| |||||||||||||||||||| |||||||    
T  25865557 cttcactccgccggtggttggagcagatttccttgcagctttggtcgcgagttgcttccttggtgccttgccgccggtggatttgcgagcagtttgct 25865460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 26592125 - 26591928
Alignment:
Q  16 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggctt 115  Q
    |||| ||||| |||||||| || |||||||| || ||||||||||| ||||| |||||||| |  |  || || ||||| || ||||| |  ||||||||    
T  26592125 gacgctggaaaggaagtttgcgaatgagaagttcggtgctcttctggtacttgcggatctcacggagtgcgacggttcctggcctgaaacggtgtggctt 26592026  T
Q  116 cttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 213  Q
    ||||||||| |||||||||||||| |||||||||||||| || || |||||||||||||  || || || ||||||||||| ||||| || |||||||    
T  26592025 cttcactccgccggtcgccggagcggatttccgagcggcttttgttgcgagctgcttccttggtgctttgccgccggtggacttgcgtgcagtttgct 26591928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 41943901 - 41943704
Alignment:
Q  16 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggctt 115  Q
    |||||||||||||||| |||||||| | ||| ||||| |||||||| || ||||||||||| |  |  ||||| || ||||| |   | | ||| || ||    
T  41943901 gacgttggaatggaagcttacggatcaaaagatcagtactcttctggtatttacggatctcacgaagtgcaacggtaccaggacgatagcgatgaggttt 41943802  T
Q  116 cttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 213  Q
    ||| ||||| ||||| |  ||||| ||||| ||||| ||||||||||| || |||||||  |||||||| || ||||||||||||||||| |||||||    
T  41943801 cttgactccaccggttgtaggagcagatttgcgagcagccttggtggccagttgcttccttggagccttgccaccggtggatttgcgagcagtttgct 41943704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 21317531 - 21317336
Alignment:
Q  16 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggctt 115  Q
    ||||||||||||||||||| |  || |||||||||||||||||||| ||||| ||||| || |  |  || || ||||| || | ||| |  ||||||||    
T  21317531 gacgttggaatggaagttttcttatcagaagctcagtgctcttctggtacttgcggatttcacgaagcgccacggttccgggacggaaacggtgtggctt 21317432  T
Q  116 cttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttg 211  Q
    ||||||||||||||||||||||||||||||||| ||||| ||||||||||| || || || || || |||||||||||||||||||| ||||||||    
T  21317431 cttcactcctccggtcgccggagctgatttccgtgcggctttggtggcgagttgtttgcgtggggcttttccgccggtggatttgcgtgctgtttg 21317336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 20 - 211
Target Start/End: Original strand, 3930136 - 3930327
Alignment:
Q  20 ttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttc 119  Q
    ||||||||||||||| |  |||||||| |||||||||||||||||||| |||||||| |  |  || |||||||| || | |||||| ||||| |||||     
T  3930136 ttggaatggaagtttcctaatgagaagttcagtgctcttctgatacttgcggatctcacgaagtgcgactgttcctggacggaatctgtgtggtttcttt 3930235  T
Q  120 actcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttg 211  Q
    || || ||||| ||||| |||||||| |  ||||| ||||||||||| || ||||| || || ||||| ||||||||||| || ||||||||    
T  3930236 acaccaccggttgccggtgctgattttcttgcggctttggtggcgagttgtttccgtggggcttttcctccggtggattttcgtgctgtttg 3930327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 39 - 145
Target Start/End: Original strand, 3928803 - 3928909
Alignment:
Q  39 atgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttcactcctccggtcgccggag 138  Q
    ||||||||||||||| |||| |||||||| | ||| || | ||| || |||||||| ||||||||||| ||||||||||||| |||||| |||||| | |    
T  3928803 atgagaagctcagtgatcttttgatacttcctgatttcacgcaatgcgactgttcctggtctgaatctgtgtggcttcttcattcctcctgtcgccagtg 3928902  T
Q  139 ctgattt 145  Q
    |||||||    
T  3928903 ctgattt 3928909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 13576301 - 13576110
Alignment:
Q  20 ttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttc 119  Q
    |||||||||||| || |  ||||||||||| ||||||||||||||||| ||||| || |  | ||| || |||||||| | ||| | |||||||||||||    
T  13576301 ttggaatggaagcttccttatgagaagctcggtgctcttctgatacttgcggatttcacgaagagcgacggttccaggacggaaacgatgtggcttcttc 13576202  T
Q  120 actcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttg 211  Q
    ||||||||||| |||||||| |||||||||||||| || |||||||| || || || || || |||||||||||||||||||| ||||||||    
T  13576201 actcctccggtggccggagcggatttccgagcggcttttgtggcgagttgtttgcgtggtgcttttccgccggtggatttgcgggctgtttg 13576110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 16 - 94
Target Start/End: Original strand, 34571617 - 34571695
Alignment:
Q  16 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttcc 94  Q
    |||| |||||||||||||||||||| | ||| || || ||||||||||||||||| ||||| |  | ||||||||||||    
T  34571617 gacgctggaatggaagtttacggatcaaaagttcggtactcttctgatacttacgtatctcacgaagagcaactgttcc 34571695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 97
Target Start/End: Original strand, 34579085 - 34579166
Alignment:
Q  16 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccagg 97  Q
    |||| ||||||||||||||||| || | ||| || || | ||||||||||||||| ||||| |  | |||||||||||||||    
T  34579085 gacgctggaatggaagtttacgaatcaaaagttcggtacccttctgatacttacgtatctcacgaagagcaactgttccagg 34579166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 97
Target Start/End: Original strand, 34584834 - 34584915
Alignment:
Q  16 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccagg 97  Q
    |||| ||||||||||||||||| || | ||| || || | ||||||||||||||| ||||| |  | |||||||||||||||    
T  34584834 gacgctggaatggaagtttacgaatcaaaagttcggtacccttctgatacttacgtatctcacgaagagcaactgttccagg 34584915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 21 - 213
Target Start/End: Complemental strand, 12531444 - 12531252
Alignment:
Q  21 tggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttca 120  Q
    ||||||||||| || |  || |||||||| ||||||||||| ||||| |||||||| |  |  ||||| ||||| || | |||||| ||||||||||| |    
T  12531444 tggaatggaagcttccttataagaagctcggtgctcttctggtacttgcggatctcacgaagtgcaacagttcctggacggaatctgtgtggcttcttga 12531345  T
Q  121 ctcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 213  Q
    |||||||||| |||||||| |||||||| || || || ||||| ||||||||||  || || |||||||||||||||||||||||||||||||    
T  12531344 ctcctccggttgccggagcagatttccgggcagctttagtggcaagctgcttccttggtgcttttccgccggtggatttgcgagctgtttgct 12531252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 21 - 213
Target Start/End: Original strand, 12547175 - 12547367
Alignment:
Q  21 tggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttca 120  Q
    ||||||||||| || |  || |||||||| ||||||||||| ||||| |||||||| |  |  ||||| ||||| || | |||||| ||||||||||| |    
T  12547175 tggaatggaagcttccttataagaagctcggtgctcttctggtacttgcggatctcacgaagtgcaacagttcctggacggaatctgtgtggcttcttga 12547274  T
Q  121 ctcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 213  Q
    |||||||||| |||||||| |||||||| || || || ||||| ||||||||||  || || |||||||||||||||||||||||||||||||    
T  12547275 ctcctccggttgccggagcagatttccgggcagctttagtggcaagctgcttccttggtgcttttccgccggtggatttgcgagctgtttgct 12547367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 42 - 211
Target Start/End: Original strand, 9866853 - 9867024
Alignment:
Q  42 agaagctcagtgctcttctgatact--tacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttcactcctccggtcgccggagc 139  Q
    ||||||||| ||||||| || ||||  |||||||||| |  |  ||||| |||||||| | ||| |  |||||||||||||||||||| || ||||||||    
T  9866853 agaagctcaatgctcttttggtactcttacggatctcacgaagcgcaacggttccaggacggaaacggtgtggcttcttcactcctcccgttgccggagc 9866952  T
Q  140 tgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttg 211  Q
    |||||||||||| || || ||||| |||| ||| |  || || || |||||||||||||||||||| |||||    
T  9866953 tgatttccgagcagcttttgtggccagcttctttcatggtgctttaccgccggtggatttgcgagccgtttg 9867024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 145
Target Start/End: Complemental strand, 9869946 - 9869843
Alignment:
Q  42 agaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggcttcttcactcctccggtcgccggagctg 141  Q
    |||||||||||||||||||| |||||||||||||| |  | |||||| |||||| | | ||| |  ||||| ||||||||| | ||||| ||| ||||||    
T  9869946 agaagctcagtgctcttctggtacttacggatctcacgaagagcaacggttccatgacagaaacagtgtggtttcttcactgccccggttgccagagctg 9869847  T
Q  142 attt 145  Q
    ||||    
T  9869846 attt 9869843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 9894514 - 9894450
Alignment:
Q  108 tgtggcttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgctt 172  Q
    |||||||||||||||  |||||  ||| |||||||||| |||||||| |||||||| ||||||||    
T  9894514 tgtggcttcttcactgttccggctgccagagctgattttcgagcggctttggtggcaagctgctt 9894450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0197 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: scaffold0197
Description:

Target: scaffold0197; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 30968 - 30774
Alignment:
Q  16 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggctt 115  Q
    |||||||||||| |||||| |  || |||||||||||||||||||| ||||| ||||| || |  |  || || ||||| || | ||| |  ||||||||    
T  30968 gacgttggaatg-aagttttcttatcagaagctcagtgctcttctggtacttgcggatttcacgaagcgccacggttccgggacggaaacggtgtggctt 30870  T
Q  116 cttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttg 211  Q
    ||||||||||||||||||||||||||||||||| ||||| ||||||||||| || || || || || |||||||||||||||||||| ||||||||    
T  30869 cttcactcctccggtcgccggagctgatttccgtgcggctttggtggcgagttgtttgcgtggggcttttccgccggtggatttgcgtgctgtttg 30774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 24860503 - 24860306
Alignment:
Q  16 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggctt 115  Q
    ||||||||||||||||||| |||||||||||||| ||||| || || ||||| ||||| || |  |  ||||| ||||| || | ||| |  || || ||    
T  24860503 gacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcggatttcgcgaagtgcaacggttccgggacggaaacggtgaggttt 24860404  T
Q  116 cttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 213  Q
    ||||||||| ||||| || ||||| |||||||| ||||| || || || ||||||||||  || || ||||| |||||||||||||||||||||||||    
T  24860403 cttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttgcgagctgtttgct 24860306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 34748712 - 34748515
Alignment:
Q  16 gacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaactgttccaggtctgaatctatgtggctt 115  Q
    |||| ||||| || ||||| |||||||| || || ||||||||||| |||||||||||||| |  | ||| || ||||| |||||||| |  || || ||    
T  34748712 gacgctggaaggggagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacgtagagcgacggttcctggtctgaaacggtgaggttt 34748613  T
Q  116 cttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 213  Q
    ||||||||| ||||| |||||||| ||||| |||||||| || ||||| || |||||||  ||||| || || || |||||||||||||| |||||||    
T  34748612 cttcactccaccggtggccggagcagatttgcgagcggcttttgtggctagttgcttccttggagctttacctccagtggatttgcgagcggtttgct 34748515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 213
Target Start/End: Original strand, 7594905 - 7594964
Alignment:
Q  154 ccttggtggcgagctgcttccggggagcctttccgccggtggatttgcgagctgtttgct 213  Q
    |||||||||||||||||||||  |||||||| || ||||| || |||||||| |||||||    
T  7594905 ccttggtggcgagctgcttccttggagccttaccaccggtagacttgcgagcggtttgct 7594964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 7594438 - 7594490
Alignment:
Q  24 aatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctc 76  Q
    |||||||| || ||||| | ||||||||| |||||||| ||||||||||||||    
T  7594438 aatggaagcttgcggatcaaaagctcagtactcttctggtacttacggatctc 7594490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University