View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11265_high_30 (Length: 210)
Name: NF11265_high_30
Description: NF11265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11265_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 38275371 - 38275192
Alignment:
| Q |
19 |
ttattttctcaacagtcggtaagatgtttgttatccacgtctctaggtgtcaatgtattttgtgtgttcactgtcatgcttttagaattgagatgtctga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38275371 |
ttattttctcaacagtcggtaagatgtttgttatccacgtctctaggtgtcaatgtattttgtgtgttcactgtcatgcttttagaattgagatgtctga |
38275272 |
T |
|
| Q |
119 |
gatgattcaaggaagaatggatgatgtggttatagttttcggttctcttttatttcatcaaattcccttgtttgtctgtg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38275271 |
gatgattcaaggaagaatggatgatgtggttatagttttcggttctcttttatttcatcaaattcccttgtttgtgtgtg |
38275192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 34 - 140
Target Start/End: Complemental strand, 36870555 - 36870449
Alignment:
| Q |
34 |
tcggtaagatgtttgttatccacgtctctaggtgtcaatgtattttgtgtgttcactgtcatgcttttagaattgagatgtctgagatgattcaaggaag |
133 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| |||| |||||| |||| ||||||||||| |||||| ||||||||||| |||||||| |
|
|
| T |
36870555 |
tcggtaagatgtttgttcttcacgtctctaggtgtcaatgcatttcaagtgttctctgttatgcttttagatttgagaattctgagatgatgcaaggaag |
36870456 |
T |
|
| Q |
134 |
aatggat |
140 |
Q |
| |
|
||||||| |
|
|
| T |
36870455 |
aatggat |
36870449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University