View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11265_low_23 (Length: 253)
Name: NF11265_low_23
Description: NF11265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11265_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 14 - 127
Target Start/End: Original strand, 2507440 - 2507553
Alignment:
| Q |
14 |
agactgagtatattgcataacatggattctatgtcaaaagagtagctgacgaattctgtcatttatcttgtcacttgggatacagttctatatggtggta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2507440 |
agactgagtatattgcataacatggattctatgtcaaaagagtagctgacgaattctgtcatttatcttgtcacttgggatacagttctatatggtggta |
2507539 |
T |
 |
| Q |
114 |
tcagtacaaaattt |
127 |
Q |
| |
|
| ||||| ||||| |
|
|
| T |
2507540 |
tatgtacagaattt |
2507553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University