View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11265_low_23 (Length: 253)

Name: NF11265_low_23
Description: NF11265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11265_low_23
NF11265_low_23
[»] chr2 (1 HSPs)
chr2 (14-127)||(2507440-2507553)


Alignment Details
Target: chr2 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 14 - 127
Target Start/End: Original strand, 2507440 - 2507553
Alignment:
14 agactgagtatattgcataacatggattctatgtcaaaagagtagctgacgaattctgtcatttatcttgtcacttgggatacagttctatatggtggta 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2507440 agactgagtatattgcataacatggattctatgtcaaaagagtagctgacgaattctgtcatttatcttgtcacttgggatacagttctatatggtggta 2507539  T
114 tcagtacaaaattt 127  Q
    |  ||||| |||||    
2507540 tatgtacagaattt 2507553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University