View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11266_high_19 (Length: 322)
Name: NF11266_high_19
Description: NF11266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11266_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 45846411 - 45846714
Alignment:
| Q |
1 |
gtaaccggtaatgttcgcaaagccgacagcgagtgaaccgccggctaaggcaagttcgccgaggtgaccaagaaagagcatggagatcattgaacgacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45846411 |
gtaaccggtaatgttcgcaaagccgaccgcgagtgaaccgccggctaaggcaagttcgccgaggtgaccaagaaagagcatggagatcattgaacgacaa |
45846510 |
T |
 |
| Q |
101 |
tagagtaagagaccggtgaaaatcatgggaaaagcaattttggatatagaaataatttctttgaaggtagctctaagatgggttttttggaattgtgttg |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45846511 |
tagagtaaaagaccggtgaaaatcatgggaaaagcaattttggatatagaaataacttctttgaaggtagctctaagatgggttttttggaattgtgttg |
45846610 |
T |
 |
| Q |
201 |
ttggattttctatgtttatgtctttttggataagtggattggtcatcannnnnnnnnnnnnnnnngactcttttgtgtctttgattgaaactactagata |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45846611 |
ttggattttctatgtttatgtctttttggataagtggattggtcatcatgttgttgttgttgttggactcttttgtgtctttgattgaaactactagata |
45846710 |
T |
 |
| Q |
301 |
ttca |
304 |
Q |
| |
|
|||| |
|
|
| T |
45846711 |
ttca |
45846714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University