View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11266_high_24 (Length: 242)
Name: NF11266_high_24
Description: NF11266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11266_high_24 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 32136139 - 32135915
Alignment:
| Q |
18 |
cttaaatccaattctagcatttccaatctcccttgtttttgcagaaggaagagccgtagaagattcacaacaacatgagaagctcatcttaagcgannnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32136139 |
cttaaatccaattctagcatttccaatctcccttgtttttgcagaaggaagagccgtagaagatccacaacaacatgagaagctcatcttaagcgatttc |
32136040 |
T |
 |
| Q |
118 |
nnnctttgtttcaaatattgaatctcctttctgtgtcgaacccattgaattatgtcatatcaaattccccaatcgcaagctctctgttttttgtgactgt |
217 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32136039 |
tttctttttttcaaatattgaatctcctttctgtgtcgaacccattgaattatgtcatatcaaattccccaatcgcaagctctctgttttttgtgactgt |
32135940 |
T |
 |
| Q |
218 |
tcatagttattggcacaagaatgtg |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32135939 |
tcatagttattggcacaagaatgtg |
32135915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University