View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11266_low_13 (Length: 397)
Name: NF11266_low_13
Description: NF11266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11266_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 19 - 393
Target Start/End: Original strand, 44020772 - 44021147
Alignment:
| Q |
19 |
acaacttagcttttagattcattgttttatttcttcctggttttgcatcttgatataatatgttgaggaaggaaactagtgaccatatgctgcaagacat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44020772 |
acaacttagcttttagattcattgttttatttcttcctggttttgcatcttgatataatatgttgaggaaggaaactagtgaccatatgctgcaagacat |
44020871 |
T |
|
| Q |
119 |
catacagatattggaagttcacccccttagactttgtttaggaatttggggggaaagggagggggaaggttttgatgataaaggaaggagtaaagagaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44020872 |
catacagatattggaagttcacccccttagactttgtttaggaatttggggggaaagggagggggaaggttttgatgataaaggaaggagtaaagagaat |
44020971 |
T |
|
| Q |
219 |
ggtgagtagtctctccaccttatatgagaattttatagttgtccattggactaaaccctctaatatggaggaactc--aaacattggaagagggttttga |
316 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
44020972 |
gg-gagtagtctctccaccttatatgagaattttatagttgtccattggactaaaccctctaatatggaggaactcaaaaatattggaagagggttttga |
44021070 |
T |
|
| Q |
317 |
aggattttgaaaataatttcaaatcaacaatattttcaaaattaaaataaaattactcaagtattttcatctcactc |
393 |
Q |
| |
|
||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44021071 |
aggattttgaataaattttcaaatcaacaatattttcaaaattaaaataaaattactcaagtattttcatctcactc |
44021147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University