View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11266_low_18 (Length: 347)
Name: NF11266_low_18
Description: NF11266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11266_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 314; Significance: 1e-177; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 14782396 - 14782067
Alignment:
| Q |
1 |
agtgaggaggtttttgacaagggaagtagggtttattgggtgacggttatggcgaatgtcgtgacgtggcagttttgttttatggggactgctgggatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14782396 |
agtgaggaggtttttgacaagggaagtagggtttattgggtgacggttatggctaatgtcgtgacgtggcagttttgttttatggggactgctgggatgg |
14782297 |
T |
|
| Q |
101 |
tgtttttgacatcttcattaactggtgggatttgcatgacagcattgttgtctatgaatgtgttgggtggtgttatagtttatagagatgcatttggtgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14782296 |
tgtttttgacatcttcattaactggtgggatttgcatgacagctttgttgtctatgaatgtgttgggtggtgttatagtttatagagatgcatttggtgg |
14782197 |
T |
|
| Q |
201 |
tttgaaagctgtttcaactgttatgtgtatgtggggattttgttcttatgtttatggtatgtatgttaagatgttggaagagaaagggaggatggctaag |
300 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14782196 |
tttgaaagctgtttcaactgttttgtgtatgtggggattttgttcttatgtttatggtatgtatgttaagatgttggaagagaaagggaggatggctaag |
14782097 |
T |
|
| Q |
301 |
caaaggaatgattcttccatggagttgagt |
330 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14782096 |
gaaaggaatgattcttccatggagttgagt |
14782067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 287
Target Start/End: Complemental strand, 14774509 - 14774233
Alignment:
| Q |
11 |
tttttgacaagggaagtagggtttattgggtgacggttatggcgaatgtcgtgacgtggcagttttgttttatggggactgctgggatggtgtttttgac |
110 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
14774509 |
tttttgataagggaagtttggtttattgggtgacagttatggctaatgtggtgacgtggcagttttgttttatgggaactgctggaatggtgtttttgac |
14774410 |
T |
|
| Q |
111 |
atcttcattaactggtgggatttgcatgacagcattgttgtctatgaatgtgttgggtggtgttatagtttatagagatgcatttggtggtttgaaagct |
210 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |||||| | || | ||||||||||||||||||| | || ||| |
|
|
| T |
14774409 |
atcttcattaactggtgggatttgtatgacagctttgttgtctatgaatgtgttgggaggtgttttggtgtttagagatgcatttggtggtgttaaggct |
14774310 |
T |
|
| Q |
211 |
gtttcaactgttatgtgtatgtggggattttgttcttatgtttatggtatgtatgttaagatgttggaagagaaagg |
287 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14774309 |
gtttcaactgttttgtgcatgtggggattctgttcttatgtttatggtatgtatgttaagatgttggaagagaaagg |
14774233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University