View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11266_low_27 (Length: 238)
Name: NF11266_low_27
Description: NF11266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11266_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 44 - 218
Target Start/End: Complemental strand, 11759313 - 11759138
Alignment:
| Q |
44 |
gtccagcatgagacaaggaactgcgtttccattcattgatgttttttaaattgtaaccnnnnnnngattcccagcttgcctttagatgctttttt-ggta |
142 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
11759313 |
gtccagcatgagacaaagaactgcgtttccattcattgatgttttttaaattgtaaccaaaaaaagattcccagcttgcctttagatgctttttttggta |
11759214 |
T |
 |
| Q |
143 |
attggaacggaacagtacggcaaaatggatatgaacaaaatagtgtctttatttaaaatcgagattttaacttatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11759213 |
attggaacggaacagtacggcaaaatggatatgaacaaaatagtgtctttatttaaaatcgagattttaacttatt |
11759138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University