View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11267_high_5 (Length: 300)
Name: NF11267_high_5
Description: NF11267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11267_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 2803948 - 2804212
Alignment:
| Q |
1 |
tattgtcatatcatcaaatcttttagtgttgagtctaattttagaaattttaaatttaggaggaccaaagttgccaaattaaaaatgtagggattaaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2803948 |
tattgtcatatcatcaaatcttttagtgttgagtctaattttagaaattttaaatttaggaggaccaaagttgccaaattaaaaatgtagggactaaaat |
2804047 |
T |
 |
| Q |
101 |
caaatattgtcaaaatagaggttcaaaacttgtaattaaacctattagttatnnnnnnnnnttgaaaatttatggggcttaagattgaagctttaatgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2804048 |
caaatattgtcaaaatagaggttcaaaacttgtaattaaacctagtagttat-aaaaaaaattgcaaatttatggggcttaagattgaagctttaatgac |
2804146 |
T |
 |
| Q |
201 |
ctttcgttatacattatgtgtgaattctcagagttttatcttggttgaagagggttatatttataa |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2804147 |
ctttcgttatacattatgtgtgaattctcagagttttatcttggttgaagagggttatatttataa |
2804212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 254 - 292
Target Start/End: Complemental strand, 22274504 - 22274466
Alignment:
| Q |
254 |
gttatatttataatggttaaatatgtttttggtccctat |
292 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
22274504 |
gttataattataagggttaaatatgtttttggtccctat |
22274466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 264 - 292
Target Start/End: Complemental strand, 39170246 - 39170218
Alignment:
| Q |
264 |
taatggttaaatatgtttttggtccctat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39170246 |
taatggttaaatatgtttttggtccctat |
39170218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 264 - 292
Target Start/End: Original strand, 55811077 - 55811105
Alignment:
| Q |
264 |
taatggttaaatatgtttttggtccctat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55811077 |
taatggttaaatatgtttttggtccctat |
55811105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 292
Target Start/End: Complemental strand, 16129499 - 16129467
Alignment:
| Q |
260 |
tttataatggttaaatatgtttttggtccctat |
292 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
16129499 |
tttataaaggttaaatatgtttttggtccctat |
16129467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 256 - 292
Target Start/End: Original strand, 46710222 - 46710258
Alignment:
| Q |
256 |
tatatttataatggttaaatatgtttttggtccctat |
292 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
46710222 |
tatatttttaagggttaaatatgtttttggtccctat |
46710258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University