View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11267_low_6 (Length: 293)
Name: NF11267_low_6
Description: NF11267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11267_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 4083147 - 4082873
Alignment:
| Q |
1 |
gcgtttgttgtgtttttgtccgtggttgtggcttctttggtgtttgatatcggtgttgtagggggcggcgtcaattttcttcttcgaaatcgaacactac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4083147 |
gcgtttgttgtgtttttgtccgtggttgtggcttctttggtgtttgatatcggtgttgtagggggcggcgtcaattttcttcttcgaaatcgaacactac |
4083048 |
T |
|
| Q |
101 |
atagagttgtgattatggcaatgcttgttgctaatcctattagggagaatgaaaaatatagaaatggacctatcaatgaattattggcattgtcataggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
4083047 |
atagagttgtgattatggcaatgcttgttgctaatcctattagggagaatgaaaaatttagaaatggacctattaataaattgttggcattgtcataggg |
4082948 |
T |
|
| Q |
201 |
caatcttcttcccatgacaaaagatattatctatgtaagtgatttctattgctgacaatttgttctatgttcttt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082947 |
caatcttcttcccatgacaaaagatattatcgatgtaagtgatttctattgctgacaatttgttctatgttcttt |
4082873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 80 - 123
Target Start/End: Original strand, 48203029 - 48203072
Alignment:
| Q |
80 |
ttcttcgaaatcgaacactacatagagttgtgattatggcaatg |
123 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
48203029 |
ttcttcggaatcgaaaactacatatagttgtgattatggcaatg |
48203072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University