View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11268_high_16 (Length: 436)
Name: NF11268_high_16
Description: NF11268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11268_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-128; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 138 - 430
Target Start/End: Original strand, 19165899 - 19166191
Alignment:
| Q |
138 |
ggacatatcaagagattaagaacgactcgacgacgcaggtaatgggcttgaagtttgacatagcagggatgactctagggtttatcaacggtcttcacaa |
237 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19165899 |
ggacatatcaagagattcagaacgactcgacgacacaggtaatgggctggaagtttgacatagcagggatgactctagggtttattaacggtcttcacaa |
19165998 |
T |
 |
| Q |
238 |
ggtttggcggatgcgattccttctacaggtggtacaggcaagtgcgtttctactcatgcgcgtttgtacgtgaatggcatatggcttatgagctcgacat |
337 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
19165999 |
ggtttggcagatgcgattccttctacaggtggtacaggaaagtgcgtttctactcatgcgcgtttgtacgtgaatggc--atggcttctgagctcgacat |
19166096 |
T |
 |
| Q |
338 |
ttatgattagaatggactagacatatcagtttatggatggaaggtttctttctacttcaccaacacaccagaatgcatt--cgtttttcatctca |
430 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
19166097 |
ttatgattagaatggactagacatatcagtttatggatggaaggtttctttcaacttcaccaacacactggaatgcattcccgtttttcatctca |
19166191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 19165695 - 19165758
Alignment:
| Q |
15 |
aaaaaccgcaaagcatattacgatgagaatacagagagagaggtcatgagagtcacggccaacc |
78 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19165695 |
aaaaaccgcaaagcatattacgatgagagtacagagagagaggtcatgagagtcacggccaacc |
19165758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 95 - 134
Target Start/End: Original strand, 19165754 - 19165793
Alignment:
| Q |
95 |
caaccgcgccggagtaactcgctggcggagacgaacattg |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19165754 |
caaccgcgccggagtaactcgctggcggagaggaacattg |
19165793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University