View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11268_high_26 (Length: 290)
Name: NF11268_high_26
Description: NF11268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11268_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 25 - 216
Target Start/End: Complemental strand, 47195674 - 47195470
Alignment:
| Q |
25 |
tggtgctttccttcatttaataaagacaatacttgttatagatcaagtgaactcggtcttcgtgagcttaactcggttaataa-------agataatata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||||||| |
|
|
| T |
47195674 |
tggtgctttccttcatttaataaagacaatacttgttatagatcaagtgaactcggtctccgtgagcttaactcggttaataaatacaatacataatata |
47195575 |
T |
 |
| Q |
118 |
taa-------aaggtttgaagtttgaaacccgaacaccnnnnnnnnngtcaactgactcaaacccacaacctgccccaccaagaggcgggttgacctctc |
210 |
Q |
| |
|
||| ||||| ||||||| ||| |||||||| | ||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47195574 |
taatatatgcaaggtctgaagttcgaagcccgaaca-caaaaaaaaaatcaactgactcaaacacacaacccgccccaccaagaggcgggttgacctctc |
47195476 |
T |
 |
| Q |
211 |
taacaa |
216 |
Q |
| |
|
|||||| |
|
|
| T |
47195475 |
taacaa |
47195470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 258
Target Start/End: Complemental strand, 47195455 - 47195426
Alignment:
| Q |
229 |
caaaattgtttcattgttacaaatgttatt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47195455 |
caaaattgtttcattgttacaaatgttatt |
47195426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University