View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11268_high_27 (Length: 280)
Name: NF11268_high_27
Description: NF11268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11268_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 40118693 - 40118409
Alignment:
| Q |
1 |
gtagctcactcaaatggctagcatgtgaatcagtgaagctatatcacca--------------------ttatgagcaattcaatttttggtggcaaaaa |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
40118693 |
gtagctcactcaaatggctagcatgtgaatcagtgaagctatatcaccagtttataattaacaaatatattatgagcaattctatttttggtggcaaaaa |
40118594 |
T |
|
| Q |
81 |
attctcacttattgaagtatttgaaaaggcatgcagcttcataagtattgatacactcagcagattcatagtggcatgagaggaggtgagtgcgatagac |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40118593 |
attctcacttattgaaatatttgaaaaggcatgcagcttcataagtattgatacactcagcagattcatagtggcatgagaggaggtgagtgcggtagac |
40118494 |
T |
|
| Q |
181 |
agagatgttaagataaggtatgcagcttcacaataataatatggtgataaaactcatcattttgaaaagaaaggttgtattaatt |
265 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40118493 |
agagatgttaagaaaaggtacgcagcttcacaataataatatggagataaaactcatcattttgaaaagaaaggttgtattaatt |
40118409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 43410276 - 43410226
Alignment:
| Q |
1 |
gtagctcactcaaatggctagcatgtgaatcagtgaagctatatcaccatt |
51 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43410276 |
gtagctcactcaaatgggtagcatgtgaatcagtgaagctatatcaccatt |
43410226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 55195575 - 55195529
Alignment:
| Q |
175 |
atagacagagatgttaagataaggtatgcagcttcacaataataata |
221 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
55195575 |
atagacaaagatgttgtgataaggtatgcagcttcgcaataataata |
55195529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University