View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11268_high_40 (Length: 229)
Name: NF11268_high_40
Description: NF11268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11268_high_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 38823634 - 38823537
Alignment:
| Q |
1 |
caactttgttccattctatcacgagttaatttgtaagta-----ttataatcaaactattgaaaattgccattgattttagtgtcttgtggttgtgtc |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38823634 |
caactttgttccattctatcacgagttaatttgtaagtaccttattataatcaaactattgaaaattgccattgattttagtgtcttgtggttgtgtc |
38823537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 115 - 196
Target Start/End: Complemental strand, 38823512 - 38823431
Alignment:
| Q |
115 |
gattcagaaacgcataccctcatataaggtaccgaagaacaaccaaagttattgatgataagtcgcaacagaggttcgacca |
196 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38823512 |
gattcagaaatgcacaccctcatataaggtacggaagaacaaccaaagttattgatgataagtcgcaatagaggttcgacca |
38823431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University