View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11268_low_21 (Length: 390)
Name: NF11268_low_21
Description: NF11268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11268_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 3 - 374
Target Start/End: Original strand, 12275130 - 12275499
Alignment:
| Q |
3 |
cacagatctcaggtaccacaaaatattcttgatgcagctggtgtgacttcaatatcttgatgtcgcggtctagattgcggtcgctgacatttttatgaaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12275130 |
cacagatctcaggtaccacaaaatattcttgatgcagctggtgtgacttcaatatcttgatgtcgcggtctagattgcggtcgctgacatttttatgaaa |
12275229 |
T |
 |
| Q |
103 |
actctacaataagttatttacctaaattcttgattttattttattttacagatggatgcactttctaatgggaactcattaaatgaagtggctcatattg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12275230 |
actctacaataagttatttacctaaattcttgattttattttattttacagatggatgcactttctaatgggaactcattaaatgaagtggctcatattg |
12275329 |
T |
 |
| Q |
203 |
ctaacggttcacatccgggaaactgcatttctcttcttcgcataaatgcaagttctgatttgatgtgtattatagatatagttagtaactaactatagag |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
12275330 |
ctaacggttcacatccgggaaactgcatttcccttcttcgcataaatgtaagttctgatttgatgtgtattatggatatagttagtaactaac--tagag |
12275427 |
T |
 |
| Q |
303 |
agtaaggtgaaataattaaatttgtttacacatgcaggtagcaagtaactcatctcaaaatgtagagctaat |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12275428 |
agtaaggtgaaataattaaatttgtttacacatgcaggtagcaagtaactcatctcaaaatgtagagctaat |
12275499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University