View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11268_low_24 (Length: 321)
Name: NF11268_low_24
Description: NF11268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11268_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 41630324 - 41630015
Alignment:
| Q |
1 |
tggacattcaaaaatcttatcatcgttaccatttccattcttcttcgcttcatcgcgtcaacaaatacttctatgacttcccaatgctctagaagatcgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41630324 |
tggacattcaaaaatcttatcatcgttaccattaccattcttc---gcttcatcgcgacaacaaatacttctatgacttcccaatgctctagaagatcga |
41630228 |
T |
 |
| Q |
101 |
aatgttttcccacaattttcgcataaatgcttcccacgaactcgtttcaataacttcaccttcgatattttctccaccgatccctcatcttcttcttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41630227 |
aatgttttcccacaattttcgcataaatgcttcccacgaactcgtttcaataacttcaccttcgatattttctccaccgatccctcatcttcttcttgtt |
41630128 |
T |
 |
| Q |
201 |
ccacattgttgtcgttgttcatctttcgactccatttgtccctcgaaagcatcatgagacacatagcaacatcttcttcaggtgaagtatcagaaactga |
300 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41630127 |
ccacattgttgacgttgttcatctttcgactccatttgtccctcgaaagcatcatgagacacatagcaacatcttcttcaggtgaagtatcagaaactga |
41630028 |
T |
 |
| Q |
301 |
actcacaggttct |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41630027 |
actcacaggttct |
41630015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University