View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11268_low_28 (Length: 268)
Name: NF11268_low_28
Description: NF11268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11268_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 122 - 252
Target Start/End: Original strand, 52580710 - 52580840
Alignment:
| Q |
122 |
aaaaagaaattatagatgacctaccagatttgcgaagcttgattctggtggagagaacagtcaaagttctcctaagcttatgccaccaatccatctatgt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52580710 |
aaaaagaaattatagatgacctaccagatttgcgaagcttgattctggtggagagaacagtcaaagttctcctaagcttatgccaccaatccatctgtgt |
52580809 |
T |
 |
| Q |
222 |
agtgaactggcgcaaacacagagtatgttat |
252 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |
|
|
| T |
52580810 |
agtgaactggcgcaaacacatagtatgttat |
52580840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 77 - 111
Target Start/End: Original strand, 52580679 - 52580713
Alignment:
| Q |
77 |
tgtatgtttgatattaccgaacatgcaagaaaaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
52580679 |
tgtatgtttgatattaccgaacatgcaagaaaaaa |
52580713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University