View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11268_low_29 (Length: 263)
Name: NF11268_low_29
Description: NF11268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11268_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 38 - 246
Target Start/End: Complemental strand, 43102875 - 43102667
Alignment:
| Q |
38 |
acaacgtttgcatccacgagagctcccatacacactcatcttcctcccagtactgtccaatctcccata---ccctaccattttgctgctatgaaacctt |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43102875 |
acaacgtttgcatccacgagagctcccatacacactcatcttcctcccagt---gtccaatctcccataataccctaccattttgctgctatgaaacctt |
43102779 |
T |
|
| Q |
135 |
aaatagtctttgatagtcaacctatcctcagtggcacacaaccaagtggaagatatgtatggatgataaccaaatttaggaggaccgccctacctcccaa |
234 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102778 |
aaatagtctttgatagccaacctatcctcagtggcacacaaccaagtggaagatatgtatggatgataaccaaatttaggaggaccgccctacctcccaa |
43102679 |
T |
|
| Q |
235 |
gttgatatattt |
246 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43102678 |
gttgatatattt |
43102667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University