View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11268_low_35 (Length: 248)
Name: NF11268_low_35
Description: NF11268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11268_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 3018147 - 3018328
Alignment:
| Q |
1 |
ataatattctaattacatcctatggtgactttataagcaaagaaatcattttttaggttcattgtttaacggatgtgtctagtctataccattattcagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
3018147 |
ataatattctaattacatcctatggtgactttataagcaaagaaatcattttttaggttcattgtttaacggatgtgtctagtctataccgttatttagg |
3018246 |
T |
 |
| Q |
101 |
gaacattnnnnnnntttgtttataataatggatgggtacattacaacgatgtatcagccccaccgccagacgtgtccatttga |
183 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3018247 |
gaacattaaaaaaaattgtttataataatggatgggtacattacaacgatgtatcagccccaccg-cagacgtgtccatttga |
3018328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 181 - 248
Target Start/End: Complemental strand, 3017971 - 3017904
Alignment:
| Q |
181 |
tgattgatgcatcatttgcaccgaagttcactgcatgattatttagtcaagaacatcaaccatagtac |
248 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3017971 |
tgattgatgcatcatttgcaccaaagttcactgcatgattattgagtcaagaacatcaaccatagtac |
3017904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University