View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11268_low_37 (Length: 240)
Name: NF11268_low_37
Description: NF11268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11268_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 59 - 226
Target Start/End: Complemental strand, 41631570 - 41631403
Alignment:
| Q |
59 |
tcagattcagaaatttttgtgactcttaaaaatttctagtttcttagtnnnnnnnnnnnnnnnnntcctagttagttctgtaatttcttccagagcatcc |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41631570 |
tcagattcagaaatttttgtgactcttaaaaatttatagtttcttagtaaaaaataaaataaaaatcctagttagttctgtaatttcttccagagcatcc |
41631471 |
T |
 |
| Q |
159 |
aatccaaacactgaaaaagaaactaatagtgcagtcctattgacttctttcatcattaaccgtctctg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
41631470 |
aatccaaacactgaaaaagaaactaatagtgcagtcctattggcttctttcatcattaaccgtttctg |
41631403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University