View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11268_low_38 (Length: 239)

Name: NF11268_low_38
Description: NF11268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11268_low_38
NF11268_low_38
[»] chr4 (1 HSPs)
chr4 (5-207)||(51845098-51845300)


Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 5 - 207
Target Start/End: Original strand, 51845098 - 51845300
Alignment:
5 tcctattccagaattcaaacaagatattaaatctttagacgtgtctaacaacaagttacaaggtgcaatacctggtcccttgtccaagtatgaggcaaaa 104  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51845098 tcctattccagaattcaaacaagatattaaatctttagacatgtctaacaacaagttacaaggtgcaatacctggtcccttgtccaagtatgaggcaaaa 51845197  T
105 tcttttgcaggaaatgaagagctttgtgggaagccacttgacaaagcatgcgatccttcttcggatttaacgtcaccacctagcgatggatccggacaag 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51845198 tcttttgcaggaaatgaagagctttgtgggaagccacttgacaaagcatgcgatccttcttcggatttaacgtcaccacctagcgatggatccggacaag 51845297  T
205 ata 207  Q
    |||    
51845298 ata 51845300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University