View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11268_low_39 (Length: 229)
Name: NF11268_low_39
Description: NF11268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11268_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 34326062 - 34326259
Alignment:
| Q |
18 |
gacacaagcaagacttccaacagagtttcctattagtactgttggcttctgaacaacttcatccaagaaatccaagatcaactgtttgtattgaatatta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34326062 |
gacacaagcaagacttccaacagagtttcctattagtactgttggcttctgaacaacttcatccaagaaatccaagatcaactgtttgtattgaaaatta |
34326161 |
T |
 |
| Q |
118 |
taccgcataagttaaatttggtatgctagagtgtaaataacagttcttaatcgcagttgcggtcttagttgcagttgtgctgcaaaccttgatattga |
215 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34326162 |
tacctcataagttaaatttggtaagctagagtgtaaataacagttcttaatcgcagttgcggtcttagttgcagttgttctgcaaaccttgatattga |
34326259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University