View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11269_high_21 (Length: 319)
Name: NF11269_high_21
Description: NF11269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11269_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 36 - 251
Target Start/End: Original strand, 4739014 - 4739233
Alignment:
| Q |
36 |
tggataagtaaaagagaagagcacgttaaccaggttgccctttaggttttagtgttgggttatcgttttaatcaaaaccggaaaattgactatgcaaaag |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
4739014 |
tggataagtaaaagagaagagcacgttaaccaggttgcccttcaggctttagtgcggggttatcactttaatcagaaccggaaaattgactatgcaaaag |
4739113 |
T |
|
| Q |
136 |
caacaatggaggtggactgtgcagaccggttatggacatacatagat----aaaaggctttaaatatattccttaacttattttaagttaggtcatataa |
231 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4739114 |
caacaatgggggtggactatgcagaccggttatggacatacatagataaaaaaaaggctttaaatatattccttaacttattttcagttaggtcatataa |
4739213 |
T |
|
| Q |
232 |
ctttaaaaccactctctctc |
251 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
4739214 |
ctttaaaaccaatctctctc |
4739233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University