View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11269_high_30 (Length: 250)
Name: NF11269_high_30
Description: NF11269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11269_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 53682819 - 53683026
Alignment:
| Q |
1 |
ttgagttcattgctttcagtttcttcactgctatctgtaatttccaatgaaaagagagttaatggcaaagacaaggactttgtcacttcatattaaagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682819 |
ttgagttcattgctttcagtttcttcactgctatctgtaatttccaatgaaaagagagttaatggcaaagacaaggactttgtcacttcatattaaagac |
53682918 |
T |
 |
| Q |
101 |
atgttccgtgtccgatatgtgttcagtggttacattcaccgattccattttctaaaattactatcgatgtcaatgtcgtgtctacatcaccaaattaatg |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682919 |
atgttccgtgtccgatatgtg-tcagtggttacgttcaccgattccattttctaaaattactatcgatgtcaatgtcgtgtctacatcaccaaattaatg |
53683017 |
T |
 |
| Q |
201 |
tcctaatga |
209 |
Q |
| |
|
| ||||||| |
|
|
| T |
53683018 |
ttctaatga |
53683026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University