View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11269_low_17 (Length: 364)
Name: NF11269_low_17
Description: NF11269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11269_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 16 - 348
Target Start/End: Complemental strand, 53682832 - 53682500
Alignment:
| Q |
16 |
agcaatgaactcaaaggcagagatggaatttgctgtagaagttgaagtgcttggaagggttaggcacaaaaatttgttaggtctaaggggctattgtgtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682832 |
agcaatgaactcaaaggcagagatggaatttgctgtagaagttgaagtgcttggaagggttaggcacaaaaatttgttaggtctaaggggctattgtgtt |
53682733 |
T |
 |
| Q |
116 |
ggcgatgatcaaaggcttattgtctatgattacatgccaaatctaagtctgctttctcatctccatggtcaatatgctggtgaagtgcaactcaactggc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682732 |
ggcgatgatcaaaggcttattgtctatgattacatgccaaatctaagtctgctttctcatctccatggtcaatatgctggtgaagtgcaactcaactggc |
53682633 |
T |
 |
| Q |
216 |
aaaagagaatgagcattgcaattggctctgctgaaggcattttgtaagctttcacccatccattttttattttcgatcattaaacgttaaattaaatcat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
53682632 |
aaaagagaatgagcattgcaattggctctgctgaaggcattttgtaagctttcacccatccatttttttttttcgatcattaaacgataaattaaatcat |
53682533 |
T |
 |
| Q |
316 |
gttaaaaattataatctttcgtcctcaaatatg |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
53682532 |
gttaaaaattataatctttcgtcctcaaatatg |
53682500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 27 - 96
Target Start/End: Complemental strand, 46146714 - 46146645
Alignment:
| Q |
27 |
caaaggcagagatggaatttgctgtagaagttgaagtgcttggaagggttaggcacaaaaatttgttagg |
96 |
Q |
| |
|
|||| ||||||||||||||||| || ||||| ||||| || |||||||| ||||| || ||||||||||| |
|
|
| T |
46146714 |
caaaagcagagatggaatttgcagttgaagtggaagtactaggaagggtgaggcataagaatttgttagg |
46146645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University