View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11269_low_32 (Length: 249)
Name: NF11269_low_32
Description: NF11269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11269_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 7413916 - 7414030
Alignment:
| Q |
1 |
atgcattttcagcaagtttgctttaggtttatgactattttgtatgtatgcatttcaacggttagaagctaatattataggctaaatgnnnnnnnttagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7413916 |
atgcattttcagcaagtttgctttaggtttatgactatcttgtatgtatacatttcaacggttagaagctaatattataggctaaatgaaaaaaattagt |
7414015 |
T |
|
| Q |
101 |
tgattgaaaaccagt |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7414016 |
tgattgaaaaccagt |
7414030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 164 - 234
Target Start/End: Original strand, 7414079 - 7414149
Alignment:
| Q |
164 |
gtgggattgacaaatagcctctgaatttttcgtacaaccagtgtcacatgactgcctctccatgtcacaaa |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7414079 |
gtgggattgacaaatagcctctgaatttttcgtacaaccagtgtcacatgactgcctctccatgtcacaaa |
7414149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 47 - 88
Target Start/End: Complemental strand, 47840586 - 47840545
Alignment:
| Q |
47 |
tatgcatttcaacggttagaagctaatattataggctaaatg |
88 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47840586 |
tatgcatttcaactgttagaagctaatattataggctaaatg |
47840545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 225
Target Start/End: Complemental strand, 47840452 - 47840416
Alignment:
| Q |
189 |
tttttcgtacaaccagtgtcacatgactgcctctcca |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47840452 |
ttttttgtacaaccagtgtcacatgactgcctctcca |
47840416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University