View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11269_low_35 (Length: 239)
Name: NF11269_low_35
Description: NF11269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11269_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 41581811 - 41582045
Alignment:
| Q |
1 |
ataatacataactgtcaatctgtcatagatgatgttagtgttcattctagctttgctaagtgtatgttt----gctctgcatatccttgatgcctctaaa |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
41581811 |
ataatacataactgtcaatctgtcatagatgatgttagtgttcattctagctttgctaagtgtatgtttaattgctctgcatatacttgatgcctctaaa |
41581910 |
T |
|
| Q |
97 |
attccatgtaagttatattatttgtatcttacattcatccatatgtctcttaca-------cgccagggtagataatgatagattagaatccaatcaatc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41581911 |
attccatgtaagttatattatttgtatcttacattcatccatatgtctcttacacgccactcgccagggtagataatgatagattagaatccaatcaatc |
41582010 |
T |
|
| Q |
190 |
cacgcaccttcctcactctctcactagttcatctt |
224 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41582011 |
cacgcaccttcctcactctctcattagttcatctt |
41582045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University