View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_high_116 (Length: 293)
Name: NF1126_high_116
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_high_116 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 92 - 285
Target Start/End: Complemental strand, 42646182 - 42645989
Alignment:
| Q |
92 |
ggtgccatttaatttgggaaagcacannnnnnncccatcatgggaaactttgatttttacctacaactgcctgtttatcacctgctgtgatttaaatttt |
191 |
Q |
| |
|
|||| |||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42646182 |
ggtgtcatttaatttggaaaagcacactttttttccatcatgggaaactctgatttttacctacaactgcctgtttatcacctgctgtgatttaaatttt |
42646083 |
T |
 |
| Q |
192 |
ttattaataaaaacatattataatgggcaaacattgagaaagtacttttctgaatcacctcactgacataaaatcgctacactctcttcatctc |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42646082 |
ttattaataaaaacatattataatgggcaaatattgagaaagtacttttctgaatcacctcactgacataaaatcgctacactctcttcttctc |
42645989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 92 - 285
Target Start/End: Complemental strand, 49750059 - 49749867
Alignment:
| Q |
92 |
ggtgccatttaatttgggaaagcacannnnnnncccatcatgggaaactttgatttttacctacaactgcctgtttatcacctgctgtgatttaaatttt |
191 |
Q |
| |
|
|||| ||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
49750059 |
ggtgtcatttaatttgggaaagcacattttttttctatcatggaaaactttgatttttacctacaactgtctgtgtatcacctgctgtgatttaaatttt |
49749960 |
T |
 |
| Q |
192 |
ttattaataaaaacatattataatgggcaaacattgagaaagtacttttctgaatcacctcactgacataaaatcgctacactctcttcatctc |
285 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||| |||| |
|
|
| T |
49749959 |
ttattaataaaaa-atattataatgggcaaatattgagaaaatacttttctgaatcacctccctgacataaaaccgctacactctcttcttctc |
49749867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 41875326 - 41875358
Alignment:
| Q |
27 |
aacctcatagactagtttattgaaatattgaga |
59 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
41875326 |
aaccacatagactagtttattgaaatattgaga |
41875358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University