View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_high_126 (Length: 281)
Name: NF1126_high_126
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_high_126 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 19 - 235
Target Start/End: Original strand, 14658649 - 14658863
Alignment:
| Q |
19 |
aacaaagggcacatattcgatgatcatagcactaagttacttctgacctaattgatattccttttagctaaaaaccattatgtatgtttataaatttgat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
14658649 |
aacaaagggcacatattcgatgatcatagtactaagttacttttgacctaattgatattctttttagctaaaaatcattatgtatgcttataaatttgat |
14658748 |
T |
|
| Q |
119 |
tttacatgatcttgattctacaaaattgatttcagtgtaaatacatttacgttgctgctggttactcttgggtcacatataattggagagtttcacataa |
218 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
14658749 |
tttgcatgatcttgattctacaaaattgatttcagtataaatacatttacattgttgctggttactcttgggtcac--attattggagagtttcacataa |
14658846 |
T |
|
| Q |
219 |
gaagttagacttataag |
235 |
Q |
| |
|
||||| |||||| |||| |
|
|
| T |
14658847 |
gaagtaagacttgtaag |
14658863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University