View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_high_130 (Length: 267)
Name: NF1126_high_130
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_high_130 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 29 - 267
Target Start/End: Original strand, 30788668 - 30788906
Alignment:
| Q |
29 |
attctgcatgtgcatctcatgggacaaaagttagtggtaagtatttaaaagcaaaaaattactagttgttttcttttgtttgaatgtgtaaatcccccat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30788668 |
attctgcatgtgcatctcatgggacaaaagttagtagtaagtatttaaaagcaaaaaattactagttgttttcttttgtttgaatgtgtaaatcccccat |
30788767 |
T |
 |
| Q |
129 |
cgttgaccaacaaagatacccatcaagtaaggcattatttttgattgaatgaagaaaagagagtgaaaacaaaatggcagcagctgcagtagaaacacct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30788768 |
cgttgaccaacaaagatacccatcaagtaaggcattatttttgattgaatgaagaaaagagagtgaaaacaaaatggcagcagctgcagtagaaacacct |
30788867 |
T |
 |
| Q |
229 |
agcagcagaggaggacagagatggtctctaactggaatg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30788868 |
agcagcagaggaggacagagatggtctctaactggaatg |
30788906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University