View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_high_171 (Length: 222)
Name: NF1126_high_171
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_high_171 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 161 - 216
Target Start/End: Original strand, 37304942 - 37304997
Alignment:
| Q |
161 |
cttacgcttccatttctttgatctgatgctgtgtatgactgtgataacgtttcttc |
216 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37304942 |
cttacgcttccatttcttggatctgatgctgtgtatgacggtgataacgtttcttc |
37304997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 37304781 - 37304826
Alignment:
| Q |
1 |
tctgcttagttccttcctttgcttgtcatcagtgtgttgacattcc |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
37304781 |
tctgcttagttccttcctttgcttgtcatcagggtgtggacattcc |
37304826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University