View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_high_75 (Length: 364)
Name: NF1126_high_75
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_high_75 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 131 - 364
Target Start/End: Complemental strand, 38712113 - 38711880
Alignment:
| Q |
131 |
ctttctgattgtagcatcacttgaaccgcgaaagcaaactcaaatcaagcacaacattaattcagaagaagaataaccagtatattgctcgtcttcagac |
230 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38712113 |
ctttctgattgtagcatcacttgaaccgcaaaagcaaacacaaatcaagcacaacattaattcagaagaagaataaccagtatattgctcgtcttcagac |
38712014 |
T |
 |
| Q |
231 |
catagttcataagatatttattactttttaagtcatggatagattcttatgaaatttataatttttaagtaaaaagaatactcttgttctatttatcaca |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38712013 |
catagttcataagatatttattactttttaagtcatggatagattcttatgaaatttataatttttaagtaaaaagaatactcttgttctatttatcaca |
38711914 |
T |
 |
| Q |
331 |
taaaagagaaacactttttgatcaactataaatc |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38711913 |
taaaagagaaacactttttgatcaactataaatc |
38711880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University