View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_high_93 (Length: 328)
Name: NF1126_high_93
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_high_93 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 29 - 176
Target Start/End: Complemental strand, 3567824 - 3567677
Alignment:
| Q |
29 |
aactgcgtgtaaatttcgccacttgactcattagaaaataagtgttttatatagaacacataaaaattcataaagaataaataagaaatgttacaattat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3567824 |
aactgcgtgtaaatttcgccacttgactcattagaaaataagtgttttatatagaacacataaaaattcataaagaataaataagaaatgttacaattat |
3567725 |
T |
 |
| Q |
129 |
cggccgcaacaacagaggttttgcaactgacgacacacacaagaagta |
176 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||| |||||| |
|
|
| T |
3567724 |
tggccgcaacaacagaggttttgcaaatgacgacacaaacaggaagta |
3567677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University