View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_109 (Length: 334)
Name: NF1126_low_109
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_109 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 9e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 75 - 254
Target Start/End: Complemental strand, 45557521 - 45557342
Alignment:
| Q |
75 |
tgagatgaagggtttgtgctttgtagtcatagaaatagaatagaatcaaacttatactatgataactcattcttaggtttataataaattgattttgtat |
174 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45557521 |
tgagaagaagggtttgtgctttgtagtcatagaaatagaatagaatcaaacttatactatgataactcattcttaggtttataataaattgattttgtat |
45557422 |
T |
 |
| Q |
175 |
tacatgatttattttataagcttgcaaatatttgctaacacatcacaacgtgattcttgacttttgatttggtagttttt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45557421 |
tacatgatttattttataagcttgcaaatatttgctaacacatcacaacgtgattcttgacttttgatttggtagttttt |
45557342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University