View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_110 (Length: 333)
Name: NF1126_low_110
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_110 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 30 - 170
Target Start/End: Complemental strand, 37433736 - 37433596
Alignment:
| Q |
30 |
ctttttgcacttaatagtagtttatagtctaattttaaataggttagttgggaatgtccctataggacagatatggtgagtaccatattatcggatttat |
129 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
37433736 |
ctttttgcacttaatactagtttatagtctaatttaaaataggttagttgggaatgtctctataggacagatatggtgagtaccatattattggatttct |
37433637 |
T |
 |
| Q |
130 |
gactgcttcaataacgtcagttcatttatttagtagtttat |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37433636 |
gactgcttcaataacgtcagttcatttatttagtaatttat |
37433596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 187 - 333
Target Start/End: Complemental strand, 37433463 - 37433317
Alignment:
| Q |
187 |
gagacgtcttttaactaaagacaaaacgtgagttcttatacaagacttaaagtggtcaatgcatcnnnnnnnnngtgcaggacttgagctttggaacatt |
286 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||| |
|
|
| T |
37433463 |
gagacgtcttttaactaaggacaaaacttgaggtcttatacaagacttaaagtggtcaatgcatcaaaaaaagtgtgcatgacttgatctttggaacatt |
37433364 |
T |
 |
| Q |
287 |
gacattggctatggtgatcgaaccgacgaccacatggtcgttaatca |
333 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37433363 |
gacattggctatggagatcgaaccgacgaccacatggtcgttaatca |
37433317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University