View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_117 (Length: 325)
Name: NF1126_low_117
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_117 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 76 - 229
Target Start/End: Complemental strand, 3590420 - 3590266
Alignment:
| Q |
76 |
aacaaaggaatcgatccttgaaaaa-gatgaagtaaactcaataagtgacttccaaagtccacattcaagctgagaaggagatctcatcacctattatag |
174 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3590420 |
aacaaaggaatcgatccttgaaaaaagatgaagtaaactcaataagtgacttccaaagtccacattcaagctgagaaggagatctcatcacctattatag |
3590321 |
T |
 |
| Q |
175 |
ctgaatgagtgttagctgcttctttatcgatggtactgaagagtgcgaaagttta |
229 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
3590320 |
ctgaatgagtgttagctgcttcttttccgatagtactgaagagtgcgaaagttta |
3590266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University