View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_121 (Length: 319)
Name: NF1126_low_121
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_121 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 2970228 - 2970497
Alignment:
| Q |
1 |
tttgttgtgagttcgtgctagtccaaaatctccaatctaataat-----cacgaaagaaaaatattagtcttaacaaaattcaactgttctttgtttgga |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2970228 |
tttgttgtgagttcgtgctagtccaaaatctccaatctaataatttcatcacgaaagaaaagtattagtcttaacaaaattcaactgttctttgtttgga |
2970327 |
T |
|
| Q |
96 |
tgttttcattctgaaagtaaacacacaacttcagttgagtgtgttcttttagaccaaacccacatat-----ag-------atggattaccaatggttga |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||| ||||||| || || ||||||||||||||| |
|
|
| T |
2970328 |
tgttttcattctgaaagtaaacacacaacttcagttgagtgtgttatttgaaaccaaacacacatattctaaagttgatgtattaattaccaatggttga |
2970427 |
T |
|
| Q |
184 |
agatcatgtgttacaaggatattgtttggtcggacatctctgtgtattacgttatttttgtgcaagtata |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
2970428 |
agatcatgtgttacaaggatattgtttggtctgacatctctgtgtattatgttatttttgtgcaggtata |
2970497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University