View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_124 (Length: 315)
Name: NF1126_low_124
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_124 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 30 - 149
Target Start/End: Original strand, 24887363 - 24887478
Alignment:
| Q |
30 |
acaacgagcttcagggaagaggaaattctcaagccttacaaacttgtattggtacgtatgttttttgaagaatattggtacgtatgtatgtttattactt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24887363 |
acaacgagcttcagggaagaggaaattctcaagccttacaaacaagtattggtaagtatgttttttgaagaatattggtac----gtatgtttattactt |
24887458 |
T |
|
| Q |
130 |
tcactgcatctgaatctcac |
149 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
24887459 |
ttactgcatctgaatctcac |
24887478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 24887507 - 24887563
Alignment:
| Q |
184 |
tatatatattcaatattagatcggtacctatatagtggaggtaacaatctggaaaaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24887507 |
tatatatattcaatattagatcggtacctatatagtggaggtaacaatctggaaaaa |
24887563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University