View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_126 (Length: 311)
Name: NF1126_low_126
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_126 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 178 - 300
Target Start/End: Original strand, 34596147 - 34596268
Alignment:
| Q |
178 |
tgaaaagatatttgttactgctgtttagtctgttgctatatgttaggaattatgctattgctgtctttatttgtcctagtctttaggaagcagtttcaca |
277 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34596147 |
tgaaaagatatttgttactgccgtt-agtctgtttctatatgttaggaattatgttattgttgtctttatttgtcctagtctttaggaagtagtttcaca |
34596245 |
T |
 |
| Q |
278 |
tttcattcagtcgtgtgagtatt |
300 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
34596246 |
tttcattcagtcgtttgagtatt |
34596268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 178 - 300
Target Start/End: Original strand, 34600424 - 34600545
Alignment:
| Q |
178 |
tgaaaagatatttgttactgctgtttagtctgttgctatatgttaggaattatgctattgctgtctttatttgtcctagtctttaggaagcagtttcaca |
277 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34600424 |
tgaaaagatatttgttactgccgtt-agtctgtttctatatgttaggaattatgttattgttgtctttatttgtcctagtctttaggaagtagtttcaca |
34600522 |
T |
 |
| Q |
278 |
tttcattcagtcgtgtgagtatt |
300 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
34600523 |
tttcattcagtcgtttgagtatt |
34600545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 60 - 121
Target Start/End: Original strand, 26259530 - 26259591
Alignment:
| Q |
60 |
tttcttgaatggattcaacaatggaggtttgccccattaacggttaaatgaaaattcttaat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26259530 |
tttcttgaatggattcaacaatggaggtttgccccattaacggttaaatgaaaattcttaat |
26259591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 209 - 273
Target Start/End: Complemental strand, 36479741 - 36479677
Alignment:
| Q |
209 |
gttgctatatgttaggaattatgctattgctgtctttatttgtcctagtctttaggaagcagttt |
273 |
Q |
| |
|
|||||||| ||||||||||||| ||||| ||| || |||||||||||||||||||||| ||||| |
|
|
| T |
36479741 |
gttgctatttgttaggaattataatattgttgttttcatttgtcctagtctttaggaagtagttt |
36479677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University