View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_138 (Length: 304)
Name: NF1126_low_138
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_138 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 8823325 - 8823177
Alignment:
| Q |
1 |
gcgtgtacatcaatagtgacaacctttgctcctgagctacacaagacaaaaacaagaagaagaagaaacgccaaacaacgaggtaacaagtttgctgaaa |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8823325 |
gcgtgtacatcaatggtgacaacctttgctcctgagctacacaagacaaaaacaagaagaagaaaaaacgccaaacaacgaggtaacaagtttgctgaaa |
8823226 |
T |
 |
| Q |
101 |
cagcagccattgttgtatatggtttgtaacttgcaagctagttaatctt |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8823225 |
cagcagccattgttgtatatggtttgtaacttgcaagctagttaatctt |
8823177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 182 - 291
Target Start/End: Complemental strand, 8823144 - 8823035
Alignment:
| Q |
182 |
gtgatttttactaaagcatttaagttcagttgaagtatatgaaaaacacaataaatgtaagtttatttatatgtaagcagcatgttggtttggtttgaaa |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8823144 |
gtgatttttactaaagcatttaagttcagttgaagtatatgaaaaacacaataaatgtaagtttatttatatgtaagcagcatgttggtttggtttgaaa |
8823045 |
T |
 |
| Q |
282 |
tctggtgtct |
291 |
Q |
| |
|
|||||||||| |
|
|
| T |
8823044 |
tctggtgtct |
8823035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University