View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_162 (Length: 269)
Name: NF1126_low_162
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_162 |
 | |
|
| [»] scaffold0449 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0449 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 7132 - 7218
Alignment:
| Q |
158 |
gaccaataaacccatacaaaatttcatcgttgtacaaaaacttaaaaaacatgtagaaaataaattgtcaataaccaacgactctaa |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7132 |
gaccaataaacccatacaaaatttcatcgttgtacaaaaacttaaaaaacatgtagaaaataaattgtcaataaccaacgaccctaa |
7218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0449; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 27 - 116
Target Start/End: Original strand, 7004 - 7090
Alignment:
| Q |
27 |
gcagagactacacttgcactgcacatgtggtgtcaaagtgttgtatattacaaataaaatataattagtgtgcattgcatgcaagctatc |
116 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7004 |
gcagagactacagttgcactgcatatgtggtgtcaaagtgt---atattacaaataaaatataattagtgtgcattgcatgcaagctatc |
7090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University