View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_175 (Length: 254)
Name: NF1126_low_175
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_175 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 25598825 - 25598586
Alignment:
| Q |
1 |
ataacctcaaataaggcaattcaaacaggcttctaaggctcaatcaaccaggtattatatatttggacttgagaacaaggattagtgccttggattgaaa |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25598825 |
ataacctcaaataaaccaattcaaacaggcttctaaggctcaatcaaccaggtattatatatttggacttgagaacaaggattagtgccttggattgaaa |
25598726 |
T |
 |
| Q |
101 |
aagtttatttaaattgattgatgtgaggataaagtgcaatctgccttaaggtaggacattcatgacaagaaagc-----tccaagtcatgaactgatatg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||| | || || |||| |||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
25598725 |
aagtttatttaaattgattgatgtgaggata---ttaaa-------tagggtaagacattcatgacaagaaagcaaatgtccaagtcatgaattgatatt |
25598636 |
T |
 |
| Q |
196 |
aaataggcctcacgttcaataagatacaactctaattaaaacagtattat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25598635 |
aaataggcctcacgttcaataagatacaactctaattaaaacagtattat |
25598586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University