View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1126_low_176 (Length: 253)

Name: NF1126_low_176
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1126_low_176
NF1126_low_176
[»] chr4 (2 HSPs)
chr4 (1-99)||(25815123-25815221)
chr4 (1-99)||(31251922-31252020)
[»] chr5 (1 HSPs)
chr5 (42-92)||(23052912-23052961)


Alignment Details
Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 25815123 - 25815221
Alignment:
Q  1 tagatgataaagttaggtgaaatcatatcaaacaagctcagaagttttatgcagttttggaatgctacccctaataaatcaccacttttgtgtatgaat 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25815123 tagatgataaagttaggtgaaatcatatcaaacaagctcagaagttttatgcagttttggaatgctacccctaataaatcaccacttttgtgtatgaat 25815221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 31252020 - 31251922
Alignment:
Q  1 tagatgataaagttaggtgaaatcatatcaaacaagctcagaagttttatgcagttttggaatgctacccctaataaatcaccacttttgtgtatgaat 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31252020 tagatgataaagttaggtgaaatcatatcaaacaagctcagaagttttatgcagttttggaatgctacccctaataaatcaccacttttgtgtatgaat 31251922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 42 - 92
Target Start/End: Original strand, 23052912 - 23052961
Alignment:
Q  42 aagttttatgcagttttggaatgctacccctaataaatcaccacttttgtg 92  Q
    ||||||||||||||||||||||| | |||||||||||||||||||| ||||    
T  23052912 aagttttatgcagttttggaatggt-cccctaataaatcaccacttgtgtg 23052961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University