View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_183 (Length: 252)
Name: NF1126_low_183
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_183 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 30 - 252
Target Start/End: Original strand, 9569192 - 9569415
Alignment:
| Q |
30 |
ggtttagttattatataaatctgaatattcatctcagcaagtaaacttcaaagtcttgttctttactgattctattctaaacccaaaaaatattttctaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9569192 |
ggtttagttattatataaatctgaatattcatctcagcaagtaaacttcaaagtcttgttctttactgattctattctaaacccaaaaaatatcttctaa |
9569291 |
T |
 |
| Q |
130 |
tgggtatgtatgaacgaaattggatcatccactacggcgaaagaccctgtaatggtagg-aaccatttgatttaaacaatttttctctctaaatccaacg |
228 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | ||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
9569292 |
tgggtatggatgaacgaaattggatcatccacgattgcgaaagaccccataatggtaggaaaccatttgatttaaacaaattttctctctaaatctaacg |
9569391 |
T |
 |
| Q |
229 |
tttcctaccgtttcagcatcattc |
252 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9569392 |
gttcctaccgtttcagcatcattc |
9569415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University