View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_184 (Length: 252)
Name: NF1126_low_184
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_184 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 30 - 232
Target Start/End: Complemental strand, 7211808 - 7211606
Alignment:
| Q |
30 |
caatagtcattttgtgcttacaaaaagtgagtggttcttgccaatttttgaaatggatataggtgaagccatagggcttttgaatgctctaaatttgatg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7211808 |
caatagtcattttgtgcttacaaaaagtgagtggttcttgccaattttttaaatggatataggtgaagccatagggcttttgaatgctctaaatttgatg |
7211709 |
T |
 |
| Q |
130 |
aaatatggtagggttaatagtgaatctcaccttccaatttaagcctattcatatttggctattttggattcgattatccttcattttgctaaaggggatc |
229 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7211708 |
aaatatggtagggttaatagtgaatttcaccttccaatttaaatctattcatatttggctattttggatttgattatccttcattttgctaaaggggatc |
7211609 |
T |
 |
| Q |
230 |
tga |
232 |
Q |
| |
|
||| |
|
|
| T |
7211608 |
tga |
7211606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University