View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_186 (Length: 252)
Name: NF1126_low_186
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_186 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 52188924 - 52188681
Alignment:
| Q |
1 |
tatctagaccctaacacatgagtaacccacttggcaagaagaaaaatcagtatttatatcctaaattagcaagaggacagtgccattcatacacaaacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52188924 |
tatctagaccctaacacatgagtaacccacttggcaagaagaaaaatcagtatttatatcctaaattagcaagaggacagtgccattcatacacaaacat |
52188825 |
T |
|
| Q |
101 |
aaatatcgaaatttaagatcattgtttcgagtaagagcgtgatcttcctactgtcacacaaaaataggatttaatgaattgtgtctatgattttaagctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52188824 |
aaatatcgaaatttaagatcattgtttcgagtaagagcgtgatcttcctactgtcacacaataataggatttaatgaattgtgtctatgattttaagctc |
52188725 |
T |
|
| Q |
201 |
aattcaagaaataatatctatgtcacaatccacctgcctatgat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
52188724 |
aattcaagaaataatatctatgtcacaatccacttgtctatgat |
52188681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University