View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_198 (Length: 251)
Name: NF1126_low_198
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_198 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 6 - 251
Target Start/End: Original strand, 14748373 - 14748618
Alignment:
| Q |
6 |
agcaccacagagtttaacttgtgtgtcaaccgctgtagaagattgtttgcaagaagacatatgttcttgctcattgatttcttcgaaatatttcttttag |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14748373 |
agcaccactgagtttaacttgtgtgtcaaccggtgtagaagatggtttgcaagaagacatatgttcttgctcattgatttcttcgaaatatttcttttag |
14748472 |
T |
 |
| Q |
106 |
taaaataataagaccttattaatgtcgtgtaatagatatacccataaaatatttcaagggatctaaattcttcataccaaatttgtagtacaatttaggc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
14748473 |
taaaataataagaccttattaatgtcgtgtaatagatatacccataaaatatttcaagggatctaaattcttcataccaaatttggaatacaatttaggc |
14748572 |
T |
 |
| Q |
206 |
atgatgggttggtggagagtatcagaagacaagacaagaataattt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14748573 |
atgatgggttggtggagagtatcagaagacaagacaagaataattt |
14748618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University