View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_208 (Length: 235)
Name: NF1126_low_208
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_208 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 7905855 - 7905645
Alignment:
| Q |
1 |
tcaagactttgtttgctcagctctttcccatctccgcttccttgtcttatcacccgttatctccctcatattgtagcttcactcttgccatctcatcaga |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905855 |
tcaagactttgtttgctcagctctt-cccatctccgcttccttgtcttatcacccgttatctccctcatattgtagcttcactcttgccatctcatcaga |
7905757 |
T |
 |
| Q |
101 |
cattgaaccttcttcttttaaacaggcccaaagtgatccacgttggcaacttgctatgtctcctgagctttagtgctttggaagcaactggaacatggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7905756 |
cattgaaccttcttcttttaaacaggcccaaagtgatccacgttggcaacttgctatgtcccctgagc-ttagtgctttggaagcaactggaacatggat |
7905658 |
T |
 |
| Q |
201 |
atttgtagatcct |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7905657 |
atttgtagatcct |
7905645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University