View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1126_low_208 (Length: 235)

Name: NF1126_low_208
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1126_low_208
NF1126_low_208
[»] chr7 (1 HSPs)
chr7 (1-213)||(7905645-7905855)


Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 7905855 - 7905645
Alignment:
1 tcaagactttgtttgctcagctctttcccatctccgcttccttgtcttatcacccgttatctccctcatattgtagcttcactcttgccatctcatcaga 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7905855 tcaagactttgtttgctcagctctt-cccatctccgcttccttgtcttatcacccgttatctccctcatattgtagcttcactcttgccatctcatcaga 7905757  T
101 cattgaaccttcttcttttaaacaggcccaaagtgatccacgttggcaacttgctatgtctcctgagctttagtgctttggaagcaactggaacatggat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||    
7905756 cattgaaccttcttcttttaaacaggcccaaagtgatccacgttggcaacttgctatgtcccctgagc-ttagtgctttggaagcaactggaacatggat 7905658  T
201 atttgtagatcct 213  Q
    |||||||||||||    
7905657 atttgtagatcct 7905645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University