View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1126_low_214 (Length: 222)

Name: NF1126_low_214
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1126_low_214
NF1126_low_214
[»] chr2 (2 HSPs)
chr2 (161-216)||(37304942-37304997)
chr2 (1-46)||(37304781-37304826)


Alignment Details
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 161 - 216
Target Start/End: Original strand, 37304942 - 37304997
Alignment:
161 cttacgcttccatttctttgatctgatgctgtgtatgactgtgataacgtttcttc 216  Q
    |||||||||||||||||| |||||||||||||||||||| ||||||||||||||||    
37304942 cttacgcttccatttcttggatctgatgctgtgtatgacggtgataacgtttcttc 37304997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 37304781 - 37304826
Alignment:
1 tctgcttagttccttcctttgcttgtcatcagtgtgttgacattcc 46  Q
    |||||||||||||||||||||||||||||||| |||| ||||||||    
37304781 tctgcttagttccttcctttgcttgtcatcagggtgtggacattcc 37304826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University