View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_221 (Length: 210)
Name: NF1126_low_221
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_221 |
 |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 8e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 45 - 103
Target Start/End: Original strand, 11438344 - 11438402
Alignment:
| Q |
45 |
ttttttatgaatttatgaacatgattgatgaagatgaaggaagaggaagatggaagaag |
103 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11438344 |
ttttttatgaatttatgaatatgattgatgaagatgaaggaagaggaagatggaagaag |
11438402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 36 - 83
Target Start/End: Complemental strand, 27848028 - 27847981
Alignment:
| Q |
36 |
ggtatgaagttttttatgaatttatgaacatgattgatgaagatgaag |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
27848028 |
ggtatgaagttttttatgaatttatgaatatgattgatgatgatgaag |
27847981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 37735519 - 37735471
Alignment:
| Q |
30 |
tggattggtatgaagttttttatgaatttatgaacatgattgatgaaga |
78 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37735519 |
tggattggaatgaagttttttatgaatttatgaacatgattgatgaaga |
37735471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 36011539 - 36011587
Alignment:
| Q |
30 |
tggattggtatgaagttttttatgaatttatgaacatgattgatgaaga |
78 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36011539 |
tggattggaatgaagttttgtatgaatttatgaacatgattgatgaaga |
36011587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 26 - 78
Target Start/End: Complemental strand, 19034 - 18983
Alignment:
| Q |
26 |
tttctggattggtatgaagttttttatgaatttatgaacatgattgatgaaga |
78 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
19034 |
tttctggattggaatgaa-ttttttatgaatttatgaacatgatagatgaaga |
18983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 96
Target Start/End: Original strand, 42245723 - 42245772
Alignment:
| Q |
46 |
tttttatgaatttatgaacatgattgatgaagatgaaggaagaggaagatg |
96 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
42245723 |
tttttatgaagatatgaatatgattgatgaagatgaa-gaagaggaagatg |
42245772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 46 - 79
Target Start/End: Original strand, 11502194 - 11502227
Alignment:
| Q |
46 |
tttttatgaatttatgaacatgattgatgaagat |
79 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
11502194 |
tttttatgaatttatgaatatgattgatgaagat |
11502227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University